TY  - JOUR
TI  - DKN1B mutation analyses and biochemical characteristics in patients
with symptomatic or asymptomatic primary hyperparathyroidism
AB  - Purpose: The aim of this study was to compare clinical,
biochemical and treatment modalities of the patients with
symptomatic and asymptomatic PHPT (primary
hyperparathyroidism), and evaluate whether the CDKN1B
mutation from these patients contributes to the
pathogenesis of typical, sporadic parathyroid adenomas.
Materials and Methods: In this prospective study 80
patients (66 women and 14 men, mean age 50.8 ± 12.01
years) with PHPT were enrolled. Biochemical and clinical
information were collected on patients’ sex, age,
biochemical examination and radiological findings (nuclear
99 mTc sestamibi scans scintigraphy, cervical ultrasound).
CDKN1B sequencing, and DNA isolation was performed
by using GeneMATRIX Quick Blood DNA Purification
Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-
453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and
CDKN1BR (rs786201010, c.-456_-453delCCTT)
(GGAGCCAAAAGACACAGACC) were amplified by
polymerase chain reaction (PCR) (Solis Biodyne, Estonia).
Results: A total of 80 patients diagnosed with PHPT were
included, of which 22 were symptomatic. Serum calcium
and 24-hour calcium excretion were significantly increased
in patients with symptomatic PHTP. Serum PTH levels
were similar between the two group. PHPT. CDKN1B
mutation was not detected in any patients.
Conclusion: Symptomatic patients were found to have
elevated levels of calcium levels (hypercalcaemic), 24-hour
urine calcium excretion and target organ damage (bone
disease and nephrolithiasis). Independent of PTH levels,
clinical signs and symptoms could be related with serum
calcium parameters in these patients.
AU  - SENGOZ COSKUN, NUR SINEM
AU  - Akkuş, Gamze
AU  - karagun, baris
AU  - tetiker, Tamer
DO  - 10.17826/cumj.1095425
PY  - 2022
JO  - Cukurova Medical Journal
VL  - 47
IS  - 2
SN  - 2602-3032
SP  - 852
EP  - 860
DB  - TRDizin
UR  - http://search/yayin/detay/524589
ER  -